top of page

Search Results

74 results found with an empty search

  • How to Create Unlimited AI Videos for Free Using Creative Fabrica Studio AI

    Watched the video already? Scroll down to grab the character images, image generation prompt, and Seedance 2.0 video prompt I used in the demo — all free to use for your own projects. What Is Creative Fabrica Studio AI? Creative Fabrica Studio AI is a web-based platform that brings together multiple state-of-the-art AI video generation models under one roof. Instead of subscribing to each model separately, you get access to Seedance 1.5, Seedance 2.0, Kling 3.0, Veo 3.1, Grok Imagine, Luma Ray 2, Runway 4.5, Pika 2.1, and more — all from a single dashboard. The best part? You can start with a 30-day free trial, which credits your account with 30,000 coins, giving you real creative firepower before spending a single rupee. 👉 Watch the full tutorial on YouTube How to Get Your 30,000 Free Coins When you first sign up, Creative Fabrica gives you only 5,000 coins — not enough for a meaningful video. Here is how to unlock the full trial: Log in to studio.creativefabrica.com Click the "Go Pro for Free" button on your dashboard A window titled "Try Studio AI for Free" will open Enter your billing information and activate the 30-day free trial Your account is credited with 30,000 coins instantly You can cancel any time within the 30-day window — no charge What Can You Make With 30,000 Coins? Different models have different credit costs. Here is a quick breakdown: Model Resolution Duration Coins Used Veo 3.1 Fast 720p or 1080p 6 seconds ~24,000 Grok Imagine Video 720p only 6 seconds Within 30K Seedance 2.0 Multiple Up to 11 seconds Within 30K Kling 3.0 Multiple Up to 13 seconds Within 30K With Veo 3.1 Fast, coin cost depends only on video duration — not resolution. So 720p and 1080p cost the same, which is a generous parity. Character Locking: The Feature That Changes Everything One of the most powerful features in Creative Fabrica is character locking — the ability to define your characters once and maintain their appearance consistently across multiple shots and videos. Character locking is available in three models: Grok Imagine, Seedance 2.0, and Happy Horse. How to Create a Custom Character Open the video generator workspace Click the Character icon at the top of the workspace In the pop-up, go to the My Characters tab and click Add Click "Create Character" to define a custom character Enter a character name and a @username (you will reference this in prompts) Upload 3 or more reference images of the character Optionally upload a video reference and an audio reference (for voice consistency) Click "Create Character" — it now appears under My Characters In your video prompt, simply type @username and the platform pulls in your character's reference automatically. The Demo Video I Created In the tutorial, I demonstrate a complete AI video workflow using Seedance 2.0 with two custom characters — a male character and a female character — generated from reference images I created using an AI image tool. Below are the exact assets I used. You can download the character images and use the prompts directly in Creative Fabrica Studio AI. Male Character Reference Image Female Character Reference Image The Image Generation Prompt I used the following prompt to generate the character reference images before uploading them to Creative Fabrica's character system: A photorealistic cinematic medium two-shot of a middle-aged Tamil village couple in a tense, emotional argument inside a dimly lit rustic kitchen at night. On one side, a Tamil woman with curly dark hair, wearing a light-cream floral print saree and a black blouse, has a tearful, exhausted expression. Facing her, a Tamil man with short grey-streaked hair and a mustache, wearing a light yellow-striped collared shirt with a cotton scarf (thundu) around his neck, looks back with defensive regret. The background features earthy mud-plastered walls and simple wooden furniture. A single warm, flickering oil lantern on a table between them casts dramatic shadows and a soft orange glow. Highly detailed facial expressions, shallow depth of field, 35mm film aesthetic, moody atmosphere, 16:9 aspect ratio. The Seedance 2.0 Video Prompt This is the exact prompt I used inside Creative Fabrica Studio AI to generate the demo video shown in the tutorial, with both characters referenced using their @usernames: [FORMAT]10-second cinematic video, 16:9 aspect ratio, 2K resolution, photorealistic, 35mm film aesthetic, cinematic lighting.[REFERENCE ROLES] @femalechr = The Tamil village woman, with curly dark hair, wearing a light-cream floral print saree with a black blouse.@malechr = The Tamil village man, with short grey-streaked hair, wearing a light yellow/cream striped collared shirt and a blue-and-white checked dhoti (lungi) with a cotton thundu (scarf) around his neck.[AESTHETIC & SETTING]A dimly lit, rustic Tamil village kitchen at night @img1 . Earthy mud-plastered walls and simple dark wooden furniture. A single warm, flickering oil lantern (matching the background of @image1) casts long, dramatic shadows. Heavy emotional tension, shallow depth of field, organic film grain, and natural facial micro-expressions.[TIMELINE]0-3s | Shot 1: Medium close-up of the woman (@femalechr ). She is visibly exhausted, eyes watery with tears. She puts a rustic ceramic plate down too hard on a dark wooden table, creating a sharp clink sound. Looking off-camera toward the man (@malechr ), she says in a trembling, frustrated voice: “You never listen to me.”3-6s | Shot 2: Cut to a medium close-up of the man (@malechr ). He is initially facing away, but immediately spins around, eyes wide with defensiveness and jaw tight. He gestures with his hand and shouts loudly: “Because you never stop blaming!”6-8s | Shot 3: Cut to an extreme close-up of the woman (@femalechr ). She exhales shakily, her shoulders dropping. With a cracked, fragile voice, she says: “I’m not blaming… I’m begging.”8-10s | Shot 4: Cut back to a medium close-up of the man (@malechr ). His defensive stance collapses. He sighs heavily, looking down in deep regret, then looks up at her with soft, sorrowful eyes. He speaks softly and quietly: “I don’t know how to fix this.”[AUDIO & TEXT]Enable natural audio generation. Synced realistic dialogue with Indian-accented English. Low ambient silence with subtle outdoor cricket chirps. A single, soft melancholy piano chord enters at 8s and fades out. Real-time subtitles appear centered at the bottom. Tips to Maximize Your 30,000 Free Coins Plan before generating. Every failed generation costs coins. Write your prompt carefully, review it, then submit. Use Seedance 2.0 for character-consistent narrative videos. The character locking feature in Seedance 2.0 is mature and reliable for storytelling content. Use Veo 3.1 Fast for cinematic one-shot videos. The start-frame and end-frame control gives you precise composition that other models lack. Run multiple accounts if you need volume. Once your 30,000 coins are exhausted, you can create a new account with a different email — a Google account is not required. Watch the Full Tutorial Everything covered in this blog is demonstrated live in the video — including the workspace walkthrough, character creation, and the complete video generation process from prompt to final output. 👉 Watch on YouTube: Creative Fabrica AI Video Tutorial

  • Primary Amoebic Meningoencephalitis (PAM)

    Primary Amoebic Meningoencephalitis (PAM) is a highly fatal (acute) disease that affects the central nervous system—particularly the brain. This is an acute infection, meaning once the infection begins, symptoms manifest very quickly. The rapid progression is due to the increased load of the pathogen in the host body, along with the genetic material and proteins of the pathogen acting swiftly inside the host, producing hazardous changes in a very short time.  Naegleria fowleri infection of the brain. Picture credits: Times of India The causative agent of PAM is a unicellular organism called  Naegleria fowleri .  Naegleria fowleri  is generally referred to as an amoebo-flagellate organism. Its major biological feature is that, in its life cycle, the organism passes through several different structural and functional stages. These include the  cyst stage ,  trophozoite stage , and  flagellated stage  (1).  In the flagellated stage, the organism has pseudopodia (temporary limb-like projections formed for directional movement) as well as flagella (2). In the trophozoite stage, however, the organism becomes pathogenic and capable of causing PAM. Clinical samples obtained from the nasal passages or cerebrospinal fluid of a patient with PAM typically reveal the organism in its trophozoite stage (1).  Like amoebo-flagellates, certain bacteria and viruses can also cause meningitis, but the mechanism of infection, physiological disturbances in the host, and biochemical changes in body fluids differ significantly between them (1).  Bacteria and amoebo-flagellates are both unicellular organisms, but differ structurally and genetically. Bacteria are unicellular  prokaryotes  (3), while amoebo-flagellates are unicellular  eukaryotes  (2). The defining feature of eukaryotes is the presence of a distinct, membrane-bound nucleus (4). Free-living bacteria exist, but most of them are parasitic (living in and exploiting host organisms), while some are symbiotic (living in hosts without causing harm). Amoebo-flagellates, although capable of surviving as free-living organisms, become parasitic upon entry into the human body and cause disease. They are mostly encountered in freshwater ecosystems such as ponds, pools, canals, and lakes—and more recently, their presence has also been suspected in well water. What distinguishes  Naegleria fowleri  and PAM from other forms of meningoencephalitis caused by viruses and bacteria is its  extremely high fatality rate . Global studies indicate that PAM has a mortality rate of approximately  98% .   Epidemiology of PAM in Kerala  According to scientific records published until 2024, a total of  eight confirmed PAM cases  were reported in Kerala between 2016 and 2023, mainly from the central and northern districts of the state. Unfortunately, all these patients died (1).  The district-wise breakdown is as follows:  -   Alappuzha   – 2 cases   -   Thrissur   – 2 cases   -   Malappuram   – 3 cases   -   Kozhikode   – 1 case The first case of PAM in Kerala was reported in  2016 from Alappuzha . Owing to the rapid and acute progression of PAM, in some cases, correct diagnosis is possible only at autopsy. Additionally, misdiagnosis and reporting errors lead to  under-reporting  of actual case numbers.  Recent Case Reports (2025)  On  August 14, 2025 , three consecutive PAM cases were reported in  Kozhikode district  (5).  - A  9-year-old girl from Thamarassery  died due to the infection. - A  3-month-old baby from Omassery  and a  40-year-old man from Annassery  were also infected. The infant’s condition remained very critical. Following the death of the girl, her two siblings were also tested, and her  7-year-old brother  was later confirmed positive (6).  Subsequently, two more cases were reported from  Malappuram district :  - An   11-year-old girl from Chelari , diagnosed at Kozhikode Medical College. Reports confirmed that her health remained stable.   - A   67-year-old woman from Vengara , who unfortunately succumbed to the infection.   It was confirmed that the  11-year-old girl developed infection following bathing in a local water reservoir near her home . The amoebal strain identified from the water sample matched that from the child’s clinical sample, substantiating the infection caused by  Naegleria fowleri  (7).  The Three-Month-Old Infant Case  The case of the 3-month-old infant continues to puzzle the medical community. For infection by  Naegleria fowleri , contaminated water must come into contact with the  nasal mucosal lining  (1). Initially, well water from the infant’s household was suspected, but later it was found that the amoebal strain in the water was different from that detected in the infant.  This led to new hypotheses:  - PAM does not always require exposure to water.  - The source of infection and entry route may vary.  - Other pathogenic amoebae, such as  Acanthamoeba  and  Balamuthia mandrillaris , can also cause encephalitis, potentially via soil or dust exposure (8, 9).  Current Status in Kerala (as of August 2025)  According to an article published in  The Print  on  August 20, 2025 , Kerala has reported a total of  37 PAM cases  (covering cases from 2024 to August 24, 2025).  -  13 deaths occurred in 2024   -  2 deaths occurred up to August 24, 2025  (10)  -  Total deaths: ~15 (~40%)   This suggests that the mortality rate in Kerala (~40%) is  significantly lower than the global average (~98%) .  Possible Reasons for Reduced Mortality in Kerala - Increased awareness about the disease and its symptoms   - Immediate medical attention sought soon after symptom onset   - Timely and accurate diagnosis   - Rapid commencement of treatment   References  1. Primary Amoebic Meningoencephalitis in Kerala – An Emerging Public Health Concern   2.   Wikipedia   3.   Prokaryote – Wikipedia   4.   Eukaryote – Wikipedia   5.   9-year-old girl dead as Kerala’s Kozhikode sees 3 cases of ‘brain-eating amoeba’ , Indian Express   6.   Well water could be source of infection for PAM cases, say Kerala Health officials , The Hindu   7.   11-year-old tests positive for rare amoebic infection , The Times of India   8.   Indian Express   9.   Economic Times Health   10.   Rare ‘brain-eating’ amoebic infection resurfaces in Kerala, Kozhikode district on alert , The Print

  • Gear Up for Advanced Science: IISER Thiruvananthapuram MSc Admissions Open for Varsha 2025!

    MSc admissions for Varsha 2025 are now open at IISER Thiruvananthapuram. Are you a highly motivated science or engineering graduate passionate about delving deeper into scientific research? The Indian Institute of Science Education and Research Thiruvananthapuram (IISER TVM) invites applications for its prestigious 2-Year MSc programs starting August 2025 (Varsha 2025 semester). Admissions are open for the Schools of Biology, Chemistry, Mathematics, and Physics. This is your chance to learn in a vibrant research environment and build a strong foundation for a career in science. Why Choose the MSc Program at IISER TVM? IISER TVM offers an immersive and flexible learning experience with key highlights including: Flexible Curriculum : Electives available from the second semester onwards. Cutting-Edge Core Courses : Comprehensive introductions to modern scientific frontiers. Interdisciplinary Opportunities : Choose electives across different schools. Focused Learning : Short modules and courses for foundational refreshers or exploring new areas. Customizable Research : Unique flexibility in choosing MSc project duration (one semester to a year). Diverse Environment : Learn alongside BS-MS and Integrated-PhD students from across India. Are You Eligible? Degree : A three or four-year Bachelor's degree in Sciences/Engineering/Mathematics or other relevant disciplines. Minimum Marks: General/General-EWS/OBC-NCL : 60% marks (or CGPA 6.5/10). SC/ST/PwD : 50% marks (or CGPA 5.5/10). (Students appearing for their final year exams are also eligible to apply, subject to meeting criteria upon selection). The Selection Journey: Application : Apply online via the official portal. Screening Test : Appear for the mandatory online, proctored IISERTVM MSc/IPhD Screening Test on Saturday, May 17, 2025. (The test syllabus is available on the admissions website). Interviews : Shortlisted candidates based on test performance will be invited for interviews scheduled between June 10 and June 20, 2025. Seat Availability There are 22 seats available in each School (Biology, Chemistry, Mathematics, Physics) for the MSc program. Reservations will adhere to the Government of India norms. Key Dates to Remember: Online Application Opens : April 4, 2025 (12:00 AM) Online Application Closes : May 5, 2025 (11:59 PM) IISERTVM MSc/IPhD Screening Test : May 17, 2025 Biology : 8:00 AM - 10:30 AM (Verification 8:00-8:30) Chemistry : 10:30 AM - 1:00 PM (Verification 10:30-11:00) Physics : 1:30 PM - 4:00 PM (Verification 1:30-2:00) Maths : 4:30 PM - 7:00 PM (Verification 4:30-5:00) Interviews : June 10 - 20, 2025 Last Date for Accepting Admission Offer : July 10, 2025 Arrival on Campus : July 30, 2025 How to Apply: Visit the online application portal: https://admissions.iisertvm.ac.in/mhd/index.php Read the instructions carefully and fill out the form. Upload necessary documents (photograph, DOB proof, mark sheets, certificates, etc.). Check the required document specifications here. Pay the non-refundable application fee: Rs. 1000/- (General/OBC-NCL/General-EWS) Rs. 500/- (SC/ST) Apply and retain the acknowledgment email with your application number.

  • Webinar: An Insight about Sexting and Cyber Victimization

    Join us for a free webinar : An Insight about Sexting and Cyber Victimization ! In this informative session delivered in English, Mr. Vinoth—an esteemed alumnus of Manonmaniam Sundaranar University and a former PhD scholar in Criminology—shares his expert knowledge on cyber crime and cyber laws. With extensive research and publications under his belt, Mr. Vinoth now serves as an Assistant Professor in the Dept of Research & Development at Saveetha School of Law, SIMATS, Chennai. Register below

  • Webinar: Master the CSIR UGC NET Strategies & Secrets

    If the Google form doesn't open, click the button below which will redirect you to the Google form.

  • Python @classmethod: Life Sciences Applications and Examples.

    Class methods are defined using the @classmethod decorator and enable calling a method directly on a class without requiring an instance of the class. When you want to call a method directly on a class without requiring an instance of the class, you can convert the method into a class method using the @classmethod decorator." Here, we have converted the method cls_method into a class method using the @classmethod decorator. Therefore, we were able to call the method cls_method directly on the class ClassmethodEx1. When a class method is called directly on a class, it receives the class as the first argument; consequently, when the code executes, the class is passed as an argument to the cls parameter of the class method cls_method. That is why cls.cls_var returned the value of the class variable cls_var, and cls.name returned the name of the class ClassmethodEx1. Now, let's see what happens if we call the class method on an instance instead of the class. This also worked: it returned the class variable cls_var and printed the name of the class, ClassmethodEx1. This means that even when you call the class method on an instance of the class, it still works because it passes the class as the first argument. Now, let's create an instance method within this class. It outputs as follows Error: ClassmethodEx1.inst_method() missing 1 required positional argument: 'self' - inst_method was called without an instance of the class. Here, the problem was that we called the instance method directly on the class ClassmethodEx1 without passing an instance of the class as an argument. Therefore, this will raise an error. There are two ways to solve this issue: 1. Create an instance of the class and call the instance method on that instance. 2. Call the instance method directly on the class and explicitly pass the instance as an argument. This outputs as follows: called from ClassmethodEx1 This is an instance method Now we can call the instance method by calling the method on the class ClassmethodEx1 and pass the name of the instance. This outputs as follows: called from ClassmethodEx1 This is an instance method A class variable can be accessed within both instance methods and class methods. When the class variable is accessed within an instance method, it is accessed through the instance. When you want to access the class variable within a class method, it is accessed through the class. Let's look at an example. This outputs as follows: called from instance of ClassmethodEx1 The class variable is class_variable called from class method of ClassmethodEx1 The class variable is class_variable An instance variable can be accessed within a class method, but this requires the class method to have an instance parameter in addition to the cls parameter. When the class method is called on an instance, the instance must be passed as an argument. Let's consider the example below. This outputs as follows: called from instance of ClassmethodEx1 The instance variable is: instance variable called from class method of ClassmethodEx1 Even though this code works, it is not commonly recommended to access instance data from a class method. Generally, it is well-accepted to access instance data from a specific instance. Now, let's look at an example. Let's consider a DNA sequence and calculate the percentage of each nucleotide. In this example, the DNA sequence will be assigned to a class variable, while the nucleotide for which the percentage of occurrence needs to be calculated will be assigned to an instance variable. This outputs as follows: The percentage fraction of A: 22.95% An important application of class methods is managing class-level data across various instances. Class-level data is managed within a class method. Let's look at an example. and Let's write a program that calculates the area and perimeter of a circle. In this program, we will assign the class variable 'pi' a value of 3.14 and explain how this value can be changed across multiple instances. This outputs as follows: 78.5 78.53750000000001 Class state refers to data shared across all instances of a class. This data is stored in class variables, which are defined outside of class instances. Class variables can be accessed and modified within both class methods and instance methods, although class methods are the conventional way to access and modify class state. Let's look at an example. This outputs as follows: 2 2 In this example code, we modify the class state within an instance method. Additionally, we include a class method that returns the class-level data. Now, let's examine an example of modifying class-level data using a class method. This outputs as follows: 2 2 Let's consider a real-world example. Below, we'll modify class-level data within a class method. In this example, we'll pass short nucleotide sequences as arguments to the constructor method. The complementary sequence will be generated and appended to a class-level dictionary. Additionally, we'll define a class method to retrieve this dictionary. This outputs as follows: {'ATGCCGTAATCGGTACT': 'TACGGCATTAGCCATGA', 'AATCGGTACTATGCCGT': 'TTAGCCATGATACGGCA'} {'ATGCCGTAATCGGTACT': 'TACGGCATTAGCCATGA', 'AATCGGTACTATGCCGT': 'TTAGCCATGATACGGCA'} Let's see how we can modify the class data within the instance method. This outputs as follows: {'AATGCCGTAATCGGTACT': 'TTACGGCATTAGCCATGA'} {'AATGCCGTAATCGGTACT': 'TTACGGCATTAGCCATGA'} Now, let's explore some applications of class methods. Apart from accessing and modifying class-level data, class methods can be used to create alternative constructors. Typically, a class constructor requires distinct arguments. Class methods, however, enable you to create constructors from arguments in various formats. and For instance, consider a program that wishes someone a happy birthday, referencing their age. The primary constructor takes the person's name and current age. This outputs as follows: Hi John happy birthday! You have turned 30 You can make the code more flexible by letting the user enter the year of birth. This outputs as follows: Hi john happy birthday! You have turned 30 Hi john happy birthday! You have turned 30 Here, we can see that the class method returns the instance of the class and it automatically calls the class' constructor method with name and age, even though we called the classmethod with name and the year of birth(yob). let's look at a real-life example. Let's write a code that takes a DNA sequence and calculates the number of each nucleotide. We can either give a DNA sequence as a string or provide it as a file object. This outputs as follows: The sequence: ATGCCGTAATCGGTACT contains the following nucleotides A: 4, T: 5, G: 4, C: 4 The sequence: CGGCGCGGGACAAGGTGACAGCGGCATGTGCAAAGCTGCGCCATAAGAAAAAGAAAGTGGCTTCTGGGAAAGCCACTATCTCTGAACTGAGGAGGAAGCTGGGACTAGCCGAGTCCCAGCAAGCTTCAATAAATGAGCAGGCGGCTT contains the following nucleotides A: 44, T: 23, G: 47, C: 33 You can override a class method implemented by a parent class while still accessing the original method from the subclass. Let's examine an example where a subclass overrides a class method but accesses the parent's method using super() This outputs as follows: The sequence is a Nucleotide sequence sequence: ATGCCGTAATCGGTACT The sequence is a Protein sequence sequence: ARNDEQGHILKMFPSTWYV Let's consider an example that encompasses two key use cases: Utilizing a class method as an alternative constructor. Creating a subclass that overrides the class method to implement additional functionalities, while accessing the attributes and methods of the parent class Another instance of application of @classmethod. The @classmethod can be used to generate an alternative constructor. In this example, we will use classmethod to generate subclass-specific constructors. The classmethod of the parent class returns instances of the subclass. Subclass can override the methods implemented by the baseclass while still maintain access to the functionalities of the baseclass. In the given example, a parent class would take a *.gff file as input, create necessary attributes, and generate appropriate instances of the subclass. Subclass will be able to access the attributes and methods of the baseclass, and it can also have its own implementation to enhance the functionalities. Here, I have provided a simplified typical *.gff file output by the gene prediction pipeline AUGUSTUS for demonstration purpose. Let's explore another use case of a class method that serves as a blueprint for generating content-aware subclass instances. Within the subclass, we override methods implemented by the base class while maintaining access to them. In the following example, we utilize the base class's class method to create instances of either GlobularProtein or MembraneProtein. Make sure that your pdb file and the corresponding fasta file have the same basename. Behavior of the super() function Now, finally, let's look at the behavior of super() built-in function and how it helps in the class inheritance scenarios. Also, how the behavior is influenced by regular methods and classmethods. The super() function is a built-in Python function that provides access to methods implemented by a parent class. It returns a proxy object that facilitates method calls to the parent class (or the next immediate class in the Method Resolution Order, MRO). Behavioral Variations The behavior of super() varies depending on: Whether the method called is a class method, instance method, or static method The calling context of the method Let's look at each scenario. super().method() within an Instance Method When super().method() is called within an instance method, and the method is also an instance method: super() detects the method implemented by the parent class and binds it to the instance of the subclass This is the default behavior of super() The "self" parameter of the method receives the instance of the subclass. This outputs as follows: Calling Inherited Parent Method Accessed Inherited Parent Mathod Called Inherited Parent Method Within the Child Class Now, let's see what the self refers to that was bound to the method. This outputs as follows: Calling Inherited Parent Method Accessed Inherited Parent Mathod The self refers to the instance of Child Called Inherited Parent Method Within the Child Class 2. super().method() implemented within an instance method the inherited method that is being accessed is a classmethod. Let's look at an example Now let's see what the cls refers to here. The output is as follows: Calling Inherited Parent Method Accessed Inherited Parent Mathod The self refers to Child Called Inherited Parent Method Within the Child Class. 3. super().method() was implemented within a classmethod where the inherted method that is being accessed is also a classmethod. Let's look at an example. The output is as follows: Calling Inherited Parent Method Accessed Inherited Parent Mathod Called Inherited Parent Method Within the Child Class Now, let's see if it was the class itself that was passed to the cls parameter of the inherited method The output is as follows: Calling Inherited Parent Method Accessed Inherited Parent Mathod The cls refers to Child Called Inherited Parent Method Within the Child Class 4. Now, let's see the scenario where the super().method() is implemented within a classmethod and the inherited method being accessed is an instance method. The output is as follows. It throws back a TypeError Traceback (most recent call last): File "c:\Users\USER\OneDrive\Desktop\tempCodeRunnerFile.py", line 15, in Calling Inherited Parent Method child.method() File "c:\Users\USER\OneDrive\Desktop\tempCodeRunnerFile.py", line 11, in method super().method() TypeError: Parent.method() missing 1 required positional argument: 'self' Understanding super() Behavior. When super().method() is called without arguments within a child/subclass method, it assumes two arguments: type : The enclosing class where super() is called. object_or_type : The first argument passed to the method. Explicit and Implicit Forms of super() Explicit: super(type, object_or_type) Implicit: super() (only usable within a class definition) Return Value and Method Resolution super() returns a proxy object that delegates method calls to the parent or sibling class of type. The proxy object: Searches classes in a predictable order (Method Resolution Order, MRO) determined by obj_or_Type.__mro__. Calls the method with obj_or_Type if found in the next immediate class (parent or sibling). MRO Example For Child class, MRO is: Child -> Parent -> Object Error Explanation When calling method (implemented as a regular method within Parent) using super().method() within the classmethod of Child, an error occurs because: super() expects an instance as the second argument, but receives the class instead. method is bound to the class, not an instance. The error was: Traceback (most recent call last): File "c:\Users\USER\OneDrive\Desktop\tempCodeRunnerFile.py", line 15, in Calling Inherited Parent Method child.method() File "c:\Users\USER\OneDrive\Desktop\tempCodeRunnerFile.py", line 11, in method super().method() TypeError: Parent.method() missing 1 required positional argument: 'self' Here, the Parent.method() is a regular method and expects an instance of the Type. The parent method can be called using Parent.method(self). Since super().method() was called within a classmethod, the issubclass(obj_or_type, type) is True, and the method is called with the class itself.

  • How to leverage GNU parallel to utilize multiple cores while running AUGUSTUS

    For de novo gene prediction in your genome assembly project, AUGUSTUS is a reliable tool. To get started, one can use the following command line. Here, the --species parameter specifies the organism to use as a gene model. In this case, I used maize . The --progress option displays the process. Unfortunately, when you run the command, it uses only one CPU core: AUGUSTUS does not have a built-in parameter to set the number of CPU cores. However, we can leverage GNU Parallel to utilize multiple cores. Check if the parallel is Installed and is in the PATH You can verify GNU Parallel's installation by running the following command in your terminal: parallel --version. It should output as follows. Or you can type dpkg -l | grep parallel   and it should bring If GNU Parallel is not found or installed, you can install it on Ubuntu using the following command: sudo apt-get install parallel Split the main fasta file into multiple files To divide a large FASTA file into smaller, manageable files, use the following Python script. This code splits the file in a "fasta-aware" manner, ensuring each resulting file remains valid. In the code, you can replace the value of "n" with the number of fasta files you need. Check the number of CPU cores The following command can be used to check the number of CPU cores. cat /proc/cpuinfo My server is equipped with two Intel Xeon E5-2609 processors, each featuring 4 cores. This configuration provides a total of 8 cores. To verify cores and threads per core, use lscpu Automate AUGUSTUS on multiple FASTA files in parallel, across “N” CPU cores First of all, we need to configure OpenMPI for AUGUSTUS. To control thread allocation for AUGUSTUS, set the OMP_NUM_THREADS environment variable. This variable determines the number of threads allocated to OpenMPI-enabled applications. To restrict AUGUSTUS to single-threaded operation, set: Run parallel instances of AUGUSTUS. With OMP_NUM_THREADS set, you can now run multiple instances of AUGUSTUS in parallel using GNU Parallel: parallel --jobs N augustus [options] input_files. Replace: 1. N with the desired number of parallel instances (equal to the number of cores, if hyperthreading is not supported), 2. [options] with AUGUSTUS command-line options 3. input_files with your input FASTA files. To maximize efficiency, you may set the optimum number of parallel instances; for example, set N to the number of cores, considering: 1. Single-threaded operation (OMP_NUM_THREADS=1) 2. No hyperthreading support. In my case, with 8 cores and single-threading: parallel --jobs 8 augustus [options] input_files. Now to automate, set an input directory variable (INPUT_DIR) and an output directory variable (OUTPUT_DIR), and assign them the path to the folder that contains all split input files and the path where the output files are to be created. Now 8 parallel instances of AUGUSTUS  can be run using the following command: Here, the {}  grabs each input file (each one from the group of split files) mentioned in "$INPUT_DIR"/subset_{1..8}.fasta . Each parallel job is individually redirected. Combine the output files: The  '>' "$OUTPUT_DIR"/{/}.gff3  will create individual output corresponding to each AUGUSTUS  task, and all the split output files need to be combined. This can be done by: The complete program You can find the complete program here.

  • ICAR-Training Program on Production of Arka Fermented Cocopeat and Soilless Cultivation of Vegetables

    Specialized Training Program on Arka Fermented Cocopeat and Soilless Cultivation of Vegetables ICAR-Indian Institute of Horticultural Research, a premier institution under the Indian Council of Agricultural Research, is organizing a specialized with Arka Fermented Cocopeat The training is a unique opportunity for entrepreneurs, startups, and enterprises looking to harness innovative horticultural technologies. This hands-on program will guide participants through the production of Arka Fermented Cocopeat, a sustainable substrate ideal for soilless cultivation, which has proven to be highly effective in horticulture. The training will be conducted by esteemed experts, including Dr . G . Selvakumar and Dr . D . Kalaivanan , both Principal and Senior Scientists from the Division of Natural Resources. Participants will gain valuable insights into practical applications, with the offline sessions covering both theory and practical demonstrations. Additionally, an online option is available for those who wish to attend remotely, focusing on theory sessions. Training Program Details Key Details : Venue : Video Conference Hall, Admin Building, ICAR-IIHR Date : September 20, 2024 Application Deadline : September 19, 2024 Offline Training Fee : ₹2000 (9:00 AM to 5:30 PM) Online Training Fee : ₹1000 (9:00 AM to 1:30 PM) Organized by BESST-HORT , the Technology Business Incubator of ICAR - IIHR , this program is a critical step for those aiming to develop viable skills in horticultural innovation and entrepreneurship. The training is supported by NIDHI-TBI and the Department of Science and Technology, Government of India. Register now to secure your spot in this transformative training session! Visit BESST-HORT for more information and registration details. Apply at: https://www.iihr.res.in/international-conference-plant-protection-horticulture-icpph-2024-advances-and-challenges

  • Umami Bioworks Seeks Experienced Grant Writing Specialist

    Key Responsibilities Collaborate with Leading Scientists and Researchers to Secure Essential Funding The primary responsibility of the Grant Writing Specialist is to craft compelling grant proposals aimed at securing funding from diverse sources. This involves close collaboration with Umami Bioworks' world-class team of scientists and researchers, ensuring that proposals accurately reflect the company's innovative bioengineering projects and their potential global impact. Qualifications and Expertise Required The Ideal Candidate for the Grant Writing Specialist Role Successful candidates will possess exceptional communication and writing skills, with a proven track record in securing significant grants. Familiarity with the funding landscape and experience in navigating the specific requirements of various grant agencies is critical for success in this role. Candidates must be able to articulate complex bioengineering concepts in a clear and persuasive manner. Why Choose Umami Bioworks? Be Part of a Mission-Driven Company Pioneering the Future of Bioengineering Umami Bioworks offers more than just a job; it provides a platform to work on groundbreaking projects with real-world implications. As a **Grant Writing Specialist**, professionals will have the chance to contribute to a team that is actively shaping the future of bioengineering, with innovations that could impact global health, sustainability, and food production. How to Apply? Visit: https://careers.umamibioworks.com/jobs/4795976-grant-writing-specialist

  • Bioinformatics Analyst Position - Albert Einstein College of Medicine

    Bioinformatics Analyst Position Institution: Albert Einstein College of Medicine Department: Pediatrics Job ID: 2024-16252 Location: Einstein/Resnick - Bronx Position Type: Regular Full-Time Salary Range: $58,500 - $65,000 per year Position Overview The Albert Einstein College of Medicine is seeking a motivated and experienced Bioinformatics Analyst to join Dr. Robert Burk's research group. This role is integral to supporting ongoing research projects focused on two primary areas: the human microbiome (gut, oral, and cervicovaginal) and human papillomavirus related to cervix neoplasia. Key Responsibilities Perform demultiplexing and analysis of NGS data using barcoding primers for multiplex NGS runs Process and analyze high-throughput sequencing data reads, including amplicon sequencing, bisulfite sequencing, metagenomics, and viral integration Manage and organize bioinformatics sequencing data for the research group Handle large Fastq, BAM, and/or Fasta files for analyses Utilize existing software tools and modify R scripts for figure generation and epidemiological analyses Construct phylogenetic trees to support ongoing research projects Collaborate closely with the Principal Investigator and other lab members Qualifications Bachelor's degree with at least one year of experience in epidemiology, computational biology, or bioinformatics Proficiency in R or Python Experience in microbiome bioinformatic processing (preferred) Strong communication skills, both verbal and written Ability to present at weekly lab meetings using PowerPoint or other presentation programs Excellent interpersonal skills and ability to work collaboratively Strong problem-solving skills and ability to manage time effectively Innovative approach to applying technology to improve efficiency and solve research-related problems The ideal candidate will have a background in epidemiology, computer science, bioinformatics, or related disciplines, with practical demonstrated experience in processing next-generation sequencing (NGS) data. The successful applicant will demonstrate a willingness and eagerness to adapt to new approaches, recognizing the dynamic and constantly evolving nature of the bioinformatics field. This position offers an exciting opportunity to contribute to cutting-edge research in human microbiome and papillomavirus studies at a prestigious institution. The selected candidate will work in a collaborative environment, directly reporting to Dr. Robert D. Burk, the Principal Investigator, and interacting with other lab members generating NGS data.

  • Twitter Round
  • b-facebook

© 2035 by Z-Photography. Powered and secured by Wix

PHONE:
+91 9645304093

EMAIL:
thelifesciencehub2023@gmail.com
Subscribe for Free Life Science Updates: Get Latest Research, Webinars & Career Insights!

Thanks for submitting!

Lifescience, C/o Vijithkumar, Dept. of Biotechnology,

Manonmaniam Sundaranar University, Tirunelveli, Tamil Nadu, India, PIN: 627012.

bottom of page